|
DIAGENODE DIAGNOSTICS
mouse monoclonal anti-tet2 Mouse Monoclonal Anti Tet2, supplied by DIAGENODE DIAGNOSTICS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/mouse+monoclonal+anti+tet2/pm28943313-244-57-62 Average 90 stars, based on 1 article reviews
mouse monoclonal anti-tet2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
2010 n a mouse monoclonal anti fus 2010 N A Mouse Monoclonal Anti Fus, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/FUS%2FTLS+Antibody/pm29932899-310-22-29 Average 94 stars, based on 1 article reviews
2010 n a mouse monoclonal anti fus - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Bio-Rad
2010 n a mouse anti v5 abd serotec rrid ab 322378 mouse anti nc82 kittel 2010 N A Mouse Anti V5 Abd Serotec Rrid Ab 322378 Mouse Anti Nc82 Kittel, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/Goat+anti+Rabbit+IgG/pm29772202-225-32-36 Average 96 stars, based on 1 article reviews
2010 n a mouse anti v5 abd serotec rrid ab 322378 mouse anti nc82 kittel - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Jackson Immuno
2010 n a polyclonal donkey anti rabbit igg 2010 N A Polyclonal Donkey Anti Rabbit Igg, supplied by Jackson Immuno, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/Donkey+Anti-Rabbit+IgG/pm32209459-159-182-189 Average 96 stars, based on 1 article reviews
2010 n a polyclonal donkey anti rabbit igg - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
NeuroMab
mouse monoclonal antibody Mouse Monoclonal Antibody, supplied by NeuroMab, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/Anti-PSD-95+Antibody/pmc03268343-93-14-17 Average 96 stars, based on 1 article reviews
mouse monoclonal antibody - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
NSJ Bioreagents
ha tag antibody Ha Tag Antibody, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/HA+Tag+Antibody/custom%40f52057%4030517872 Average 99 stars, based on 1 article reviews
ha tag antibody - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Bio-Techne corporation
psb 10 hydrochloride Psb 10 Hydrochloride, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/PSB+10+hydrochloride/custom%402010%4029129638 Average 99 stars, based on 1 article reviews
psb 10 hydrochloride - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Oxford Instruments
2010 n a software ![]() 2010 N A Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/Imaris/pmc07085297-840-327-333 Average 99 stars, based on 1 article reviews
2010 n a software - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Cytiva Europe
histrap hp histidine ![]() Histrap Hp Histidine, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/HisTrap+HP/pm30943413-140-148-151 Average 97 stars, based on 1 article reviews
histrap hp histidine - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
Abcam
mouse monoclonal anti cholera toxin ![]() Mouse Monoclonal Anti Cholera Toxin, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/mouse+monoclonal+Anti-SOX2+antibody/pmc07085297-840-71-76 Average 99 stars, based on 1 article reviews
mouse monoclonal anti cholera toxin - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
NZYTech Inc
expression strain bl21 ![]() Expression Strain Bl21, supplied by NZYTech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/e++coli+bl21++de3+/pm30943413-140-97-102 Average 90 stars, based on 1 article reviews
expression strain bl21 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Bionova Inc
cloning strain dh5alpha ![]() Cloning Strain Dh5alpha, supplied by Bionova Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/2010+n+a+mouse+anti+prc/cloning+strain+dh5alpha/pm30943413-140-105-108 Average 90 stars, based on 1 article reviews
cloning strain dh5alpha - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Neuron
Article Title: Positional Strategies for Connection Specificity and Synaptic Organization in Spinal Sensory-Motor Circuits
doi: 10.1016/j.neuron.2019.04.008
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig polyclonal anti-vGluT1 (CU1705) This study RRID: AB_2750940 Guinea pig polyclonal anti-vGluT1 (CU1706) This study RRID: AB_2665455 Guinea pig polyclonal anti-vGluT1 (CU1707) This study RRID: AB_2750941 Rabbit polyclonal anti-dsRed Clontech Cat#632496 Goat polyclonal anti-Choline Acetyltransferase Millipore Cat#AB144P Chicken polyclonal anti-GFP Abcam Cat#AB13970 Rabbit polyclonal anti-GFP Invitrogen Cat#A11122 Sheep polyclonal anti-GFP AbD Serotec Cat#4745–1051 Goat polyclonal anti-Cholera Toxin, B-Subunit List Biologicals RRID: AB_10013220; Cat#703 Mouse monoclonal anti-Cholera Toxin, B-Subunit Abcam Cat#AB35988 Bacterial and Virus Strains scAAV6-CBh-GFP UNC Vector Core (VC) scAAV6-CBh-GFP scAAV6-CMV-Cre This study This study/ Custom UNC VC packaging scAAVI -CMV-Cre This study This study/ Custom UNC VC packaging scAAV9-CMV-Cre This study This study/ Custom UNC VC packaging Rabies SAD-B19 ΔG-GFP Wickersham et al., 2007 N/A Chemical, Peptides, and Recombinant Proteins Cholera Toxin B Subunit (low salt) List Biologicals Cat#104 Dextran, Fluorescein, 3000MW, Anionic, Lysine Fixable Invitrogen Cat#D-3306 Dextran, Tetramethylrhodamine, 3000MW, Anionic, Lysine Fixable Invitrogen Cat#D-3308 Experimental Models: Organisms/Strains Olig2::cre Dessaud et al., 2007 MGI:3774124 FoxP1 conditional Feng etal., 2010 N/A PV::FlpO Madisen et al., 2015 Jax 022730 Ai65 (RCFL-tdT) Madisen et al., 2015 Jax 021875 Ai14 (RCL-tdT) Madisen et al., 2010 Jax 007914 ChAT::cre Rossi et al., 2011 Jax 006410 Experimental Models: Cell Lines HEK293 Sigma Cat#85120602–1VL B7GG Zampieri et al., 2014 Ed Callaway Oligonucleotides FoxP1 Primer 1 5′ CTCCTAGTCACCTTCCCCAGTGC 3′ Feng et al., 2010 N/A FoxP1 Primer 2 5′ G AAC ACT GT CG AAT G ACCCTGC 3′ Feng et al., 2010 N/A Cre-F 5′ TTGCCGCGCCATCTGCCACCA 3′ This study N/A Cre-R 5′ CTAAT CG CC AT CTT CC AG 3′ This study N/A PVFlpO 16211 5′ TGTTTCTCCAGCATTTCCAG 3′ Madisen et al., 2015 N/A PVFlpO 17564 5′ GGATGCTTGCCGAAGATAAG 3′ Madisen et al., 2015 N/A PvFlpO 17566 5′ CTGAGCAGCTACATCAACAGG 3′ Madisen et al., 2015 N/A RosaTomWT-F 5′ AAGGGAGCTGCAGTGGAGTA 3′ Madisen et al., 2010 N/A RosaTomWT-R 5′ CCGAAAATCTGTGGGAAGTC 3′ Madisen et al., 2010 N/A RosaTomMut-F 5′ GGCATTAAAGCAGCGTATCC 3′ Madisen et al., 2010 N/A RosaTomMut-R 5′ CTGTTCCTGTACGGCATGG 3′ Madisen et al.,
Techniques: Virus, Plasmid Preparation, Recombinant, Software
Journal: Neuron
Article Title: Positional Strategies for Connection Specificity and Synaptic Organization in Spinal Sensory-Motor Circuits
doi: 10.1016/j.neuron.2019.04.008
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea pig polyclonal anti-vGluT1 (CU1705) This study RRID: AB_2750940 Guinea pig polyclonal anti-vGluT1 (CU1706) This study RRID: AB_2665455 Guinea pig polyclonal anti-vGluT1 (CU1707) This study RRID: AB_2750941 Rabbit polyclonal anti-dsRed Clontech Cat#632496 Goat polyclonal anti-Choline Acetyltransferase Millipore Cat#AB144P Chicken polyclonal anti-GFP Abcam Cat#AB13970 Rabbit polyclonal anti-GFP Invitrogen Cat#A11122 Sheep polyclonal anti-GFP AbD Serotec Cat#4745–1051 Goat polyclonal anti-Cholera Toxin, B-Subunit List Biologicals RRID: AB_10013220; Cat#703
Techniques: Plasmid Preparation, Recombinant, Software